Emergency measures for tomato and capsicum seed: Tomato brown rugose fruit virus

​​Questions and Answers – 24 June 2019

Emergency measures

Note: Information on this page is subject to change as new developments occur

[expand all]

What is Tomato brown rugose fruit virus (ToBRFV)?

  • ToBRFV is a member of the Tobamovirus genus:
    • It is transmitted through propagation materials (seeds, plants for planting, grafts, cuttings), and spreads locally by contact (direct plant to plant contact, contaminated tools, hands, or clothing and by bees).
    • It can remain infective in seeds, plant debris and contaminated soil for months.
    • It has plant disease resistance breaking capabilities for commercial cultivars of tomato.
  • ToBRFV naturally infects tomato and capsicum fruit resulting in unmarketable fruit:
    • On tomato, foliar symptoms include chlorosis, mosaic and mottling with occasional leaf narrowing. Necrotic spots may appear on peduncles, calyces and petioles. Fruit show yellow or brown spots, with rugose symptoms rendering the fruits non-marketable. Fruits may be deformed and have irregular maturation.
    • On capsicum, foliar symptoms include deformation, yellowing and mosaic. Capsicum fruits are deformed, with yellow or brown areas or green stripes.

What is the distribution of ToBRFV overseas?

  • The virus has been reported in Canada, Germany, Israel, Italy, Jordan, Mexico, USA (California), and Northern Palestine—seed lots from these countries may be of greater potential risk.
  • However, given the global nature of the seed production cycle, it is likely that the distribution of ToBRFV may be greater than that reported in published records.

Why has Australia implemented emergency measures for tomato and capsicum seed?

  • ToBRFV is an emerging biosecurity risk to the Australian tomato and capsicum production industries.
    • ToBRFV naturally infects tomato and capsicum resulting in unmarketable fruit.
    • Potentially at-risk Australian industries include tomato, capsicum and chilli with values of annual production of $645.2, $172.4 and $9.4 million, respectively during 2015/16 (total $827 million).
    • Like other Tobamoviruses, there is no effective seed treatment option available for commercial quantities of ToBRFV infected seed.
    • ToBRFV is NOT known to be present in Australia.

What evidence exists for ToBRFV spread through the movement of tomato and capsicum seed?

  • ToBRFV has rapidly expanded its global distribution since first reported in 2014. The first outbreak of this virus was reported on tomatoes in Israel in 2014, and then in Jordan (2015), Mexico (2018), Germany (2018), USA (California) (2018), Italy (Sicily) (2019) and Northern Palestine (2019).
  • Global movement via seed appears to be the only credible explanation for the observed intercontinental movement of ToBRFV.
  • ToBRFV is a member of the Tobamovirus genus. These viruses are known to be seed-borne, can remain viable in seeds for months, and are known to be associated with the seed coat and endosperm.
  • Several tobamoviruses are recognised as economically important seed-borne quarantine pests, including Cucumber green mottle mosaic virus (CGMMV), Kyuri green mottle mosaic virus (KGMMV) and Zucchini green mottle mosaic virus (ZGMMV).
  • The European and Mediterranean Plant Protection Organization (EPPO) advised in a recent alert that they consider ToBRFV to be seed-borne.
  • Mexico has introduced phytosanitary measures for the testing of imported seed for sowing of host species and allege extensive positive test results on imported seeds originated from 14 countries from three continents, including Asia.
  • Turkey implemented emergency measures effective 15 March 2019, for the RT-PCR testing of imported tomato and capsicum seeds originating from Jordan, Germany, Israel, Italy and Mexico.
  • New Zealand implemented emergency measures for imported tomato and capsicum seeds, effective 28 March 2019. Measures are that seeds be sourced from pest free areas or a 'pest-free place of production', or tested by ELISA and found free of ToBRFV.

Implementation of emergency measures

[expand all]

To which host species do the emergency measures apply?

  • The department has responded to the emerging risk of ToBRFV being associated with imported tomato (Solanum lycopersicum) and capsicum (Capsicum annuum species complex) seed for sowing by introducing emergency measures.
  • The emergency measures on capsicum are applied to Capsicum annuum species complex (C. annuum, C. chinense and C. frutescens) because:
    • ToBRFV is likely to be seed-borne in all three species, which are closely related
    • Hybrids of the three species are commonly bred and distributed globally
    • Seeds of the three species within the complex are similar in appearance and thus difficult to distinguish
    • Seed traders usually only identify seeds using the common name ‘capsicum’.

How were emergency measures implemented?

  • Emergency measures commenced on 5 March 2019.
  • To be least trade restrictive, the emergency measures were implemented in three phases:
    • Consignments shipped from an exporting country before midnight preceding 5 March 2019 were permitted entry into Australia under existing arrangements (no additional measures).
    • Phase 1 (interim): Tested on a sample size of 3,000 seeds (or 20 per cent for small seed lots) using the existing commercial seed test protocol (ISTA 7-028).
    • Phase 2 (interim): Tested by enzyme-linked immunosorbent assay (ELISA) on a sample size of 20,000 seeds (or 20 per cent for small seed lots) using an existing commercially available kit (AGDIA–TMV or Prime Diagnostics–ToMV).
    • Phase 3 (ongoing): Tested by PCR on a sample size of 20,000 seeds (or 20 per cent for small seed lots) using a department–approved protocol.
  • Phytosanitary certification requirements: Consignments of seed lots of tomato and capsicum that are tested off-shore must be accompanied by an official government Phytosanitary Certificate. This must be endorsed either with an appropriate additional declaration or accompanied by a laboratory test report.

What ELISA kits were considered appropriate by the department for Phase 2?

  • Two commercially available ELISA kits were considered appropriate by the department: AGDIA–TMV and Prime Diagnostics–ToMV:
    • According to current available data, both AGDIA–TMV and Prime Diagnostics–ToMV kits were effective in detecting ToBRFV in contaminated seeds.
    • Proposed use of other ELISA Kits was considered on a case-by-case basis.

Will the department consider restricting Phase 2 (the ELISA test)?

  • Developing and validating a PCR-based protocol may take several weeks for Australian diagnostic labs to complete. The department is engaging in international collaboration to speed up this process.
  • As a PCR test (Phase 3) is the desired measure, it will be adopted as soon as it becomes available.
  • However, the department recognises that overseas laboratories may need time to implement department-approved PCR testing protocols. Therefore, Phase 2 (ELISA) and Phase 3 (PCR) conditions will BOTH be permitted to run concurrently from 1 April to midnight preceding 15 April 2019 to facilitate an orderly transition to Phase 3.
  • The concurrent operation of Phase 2 (ELISA) and Phase 3 (PCR) conditions will cease at midnight preceding 15 April 2019, at which time ONLY Phase 3 (PCR) conditions will be permitted.

When will Phase 3 be implemented?

  • Phase 3 will now be implemented on 1 April 2019 because department-approved PCR testing protocols have been developed (noting, the limited concurrent operation of Phase 2 and Phase 3 conditions).
  • A PCR test (Phase 3) is the desired measure because:
    • Use of the PCR test will only marginally increase the cost for the tomato and capsicum industries, as a separate process will not be required beyond existing requirements for other viruses/viroids. This is because the nucleic acid extraction already used for existing PCR tests can also be used to undertake the new PCR test for ToBRFV.
    • Efficacy of a PCR test is generally higher than that of an ELISA test.

Seed lots that were tested under Phase 1 or 2 conditions prior to 1 April 2019 will be permitted to enter Australia provided the test date is confirmed by the laboratory report.

What are the details of the department-approved PCR testing protocol(s)?

  • In response to comments from stakeholders and recent test results, Australia has reviewed the previously approved PCR primers and updated the Approved list (effective 7 June 2019).
  • Australia has finalised PCR protocols with recommended primers for the detection of ToBRFV, which are now published on this website. Australian laboratories have also verified additional primers as requested by stakeholders, which are now included in the approved list.

Approved PCR primers and protocols

Date approved Primers PCR protocols
 
1 April 2019  F-5476 GAAGAAGTTGTTGATGAGTTCAT
R-6287 GATTTAAGTGGAGGGAAAAACAC

Reference
Levitzky, N, Smith, E, Lachman, O, Luria, N, Mizrahi, Y, Bakelman, H, Sela, N, Laskar, O, Milrot, E & Dombrovsky, A, 2019, ‘The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes’ PloS one, volume14, issue 1, p.e0210871.
Protocol as specified by Levitzky et al. 2019
1 April 2019  ToBRFV - F - AATGTCCATGTTTGTTACGCC
ToBRFV - R - CGAATGTGATTTAAAACTGTGAAT

Reference
Alkowni, A, Alabdallah, O & Fadda, Z 2019, ‘Molecular identification of tomato brown rugose fruit virus in tomato in Palestine’ Journal of Plant Pathology, available at DOI 10.1007/s42161-019-00240-7.
Protocol as specified by Alkowni et al. 2019  
7 June 2019    CSP1325 – F – CATTTGAAAGTGCATCCGGTTT
CSP1325 – R – GTACCACGTGTGTTTGCAGACA

CSP1325 – P – ([VIC*] – ATGGTCCTCTGCACCTGCATCTTGAGA [BHQ1])
*can be FAM

Reference
ISHI-Veg 2019. Detection of Infectious Tomato brown
rugose fruit virus (ToBRFV) in Tomato and Pepper Seed.
https://www.worldseed.org/wp-content/uploads/2019/05/Tomato-ToBRFV_2019_1.2.pdf

Australian protocol (RT-qPCR)

Set up RT-PCR cycles:

  • 48 °C for 30 min
  • 94 °C for 5 min
  • 40 cycles of 94 °C for 10 sec., 60 °C for 30 sec.
24 June 2019    CaTa28 – F – GGTGGTGTCAGTGTCTGTTT
CaTa28 – R – GCGTCCTTGGTAGTGATGTT
CaTa28 – P – (6FAM – AGAGAATGGAGAGAGCGGACGAGG [BHQ1])

Reference
ISHI-Veg 2019. Detection of Infectious Tomato brown
rugose fruit virus (ToBRFV) in Tomato and Pepper Seed.
https://www.worldseed.org/wp-content/uploads/2019/05/Tomato-ToBRFV_2019_1.2.pdf
Australian protocol (RT-qPCR)

Set up RT-PCR cycles:
  • 50 °C for 10 min
  • 95 °C for 3 min
  • 40 cycles of 95 °C for 10 sec., 60 °C for 60 sec.
  • The department may consider other PCR primers and protocols on a case-by-case basis.
  • Note, PCR-amplified products from positive test results can be sequenced to confirm detection of ToBRFV.
  • NPPOs that propose other PCR protocols should provide a submission with evidence of test efficacy, through the SPS contact point.

PCR primers removed from the Approved list

Primers Comment
TobamodF
TKGAYGGNGTBCCNGGNTGYGG
TobamodR
ACNGAVTBNABCTGTAATTGCTAT

Reference:
Li, Y, Tan, G, Lan, P, Zhang, A, Liu, Y, Li, R, & Li, F, 2018, ‘Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers’ Journal of virological methods, volume 259, pp.122-128.
  • Recent test results have indicated that the primers used by Li et al. (2018) lacked sensitivity in seed extracts compared to other approved primers, therefore, they were removed from the approved list (effective 7 June 2019).

Will the PCR test in Phase 3 be harmonised globally?

  • The department supports any goal of adopting a globally approved and appropriate test. However, there is a current need to act urgently, and this is not initially possible.

Why does the department require a seed sample size of 20,000 for PCR tests?

  • Based on preliminary pest risk assessment of ToBRFV, a sample size of at least 20,000 seeds is required. This sample size provides a 99 per cent confidence level of detection of a contamination rate of 0.02 per cent or above.
  • Note, the nucleic acid extraction already used for existing PCR tests can also be used to undertake the new PCR test for ToBRFV.

Is pooling permitted for the testing of small seed lots for breeding purposes?

  • Yes, but the import requirements for pooling are currently under review.

Will the department consider increasing the sub-sample size for the PCR test in phase 3?

  • The department will require the PCR test in Phase 3 to be conducted on sub-sample sizes of no more than 400 seeds in the first instance (i.e. 50 tests, each on 400 seeds).
  • A larger sub-sample size may risk false negative test results.
  • However, the department will continue to consider the possibility of increasing the sub-sample size.

Will a risk assessment be required to technically justify the emergency measures?

  • The SPS Agreement permits Australia to implement emergency actions, including emergency measures, when a new or unexpected phytosanitary risk is identified.
  • Ongoing need for the continuance of measures will be evaluated by a pest risk analysis as soon as possible, to ensure that any continuance is technically justified. 

How has the department notified stakeholders of these emergency measures?

  • The department held a teleconference with representatives of the seed production sector on 22 February 2019, to brief and consult regarding the emerging risk of ToBRFV.
  • An initial BICON alert was released (25 February 2019) to advise of the emerging risk of ToBRFV and the actions that the department is taking to manage this risk in tomato and capsicum seed imports.
  • Import permit holders were notified on 28 February 2019 by a formal BICON alert before emergency measures commenced.
  • An SPS notification was released on 1 March 2019 to notify overseas trading partners.
  • A teleconference was held on 7 March 2019 with representatives of governments of states and territories; potentially affected industry parties and members of Plant Health Australia were invited to participate.
  • A BICON alert was released (26 March 2019) to advise of the implementation of Phase 3 emergency measures (PCR test) effective 1 April 2019.
  • An SPS notification addendum will advise overseas trading partners of the implementation of Phase 3 emergency measures (PCR test) effective 1 April 2019.

What initial on-farm biosecurity practices should growers take?

  • It is possible that tomato and capsicum seeds infected with ToBRFV may have entered Australia prior to the introduction of emergency measures on 5 March 2019. Therefore, growers are strongly encouraged to familiarise themselves with the symptoms of ToBRFV infection on host crops and ensure that they have effective on-farm biosecurity practices in place, especially being vigilant for any unusual signs of virus infection on host crops.
  • Growers are also advised to contact their seed suppliers to seek their assurance about what specific testing has been applied to batches of seeds and whether they have been appropriately tested for ToBRFV.
  • Reported symptoms of ToBRFV infection include:
    • On tomato, foliar symptoms include chlorosis, mosaic and mottling with occasional leaf narrowing. Necrotic spots may appear on peduncles, calyces and petioles. Fruit show yellow or brown spots, with rugose symptoms rendering the fruits non-marketable. Fruits may be deformed and have irregular maturation.
    • On capsicum, foliar symptoms include deformation, yellowing and mosaic. Capsicum fruits are deformed, with yellow or brown areas or green stripes.