Emergency measures for tomato and capsicum seed: Tomato mottle mosaic virus (ToMMV) Questions and Answers

Emergency measures

[expand all]

What is Tomato mottle mosaic virus (ToMMV)?

  • ToMMV is a member of the Tobamovirus genus:
    • It is transmitted through propagation materials (seeds, plants for planting, grafts, cuttings), and spreads locally by contact including direct plant-to-plant contact, contaminated tools, hands, or clothing and by bees.
    • Tobamoviruses can remain infective in seeds, plant debris and contaminated soil for months.
    • It has plant disease resistance breaking capabilities for commercial cultivars of tomato.
  • ToMMV naturally infects tomato and capsicum resulting in unmarketable fruit:
    • On tomato, symptoms include severe necrotic lesions, chlorosis, leaf distortion, mottle and systemic crinkling symptoms and fruit necrosis. Disease incidences of up to 87% have been reported.
    • On capsicum, symptoms include foliar mottle, shrinking and necrosis.
    • On eggplant, disease incidences of 20-40% have been reported. However, the symptoms observed (dark purple mottle on flowers, and mosaic and distortion on leaves) on eggplant were the result of a mixed infection involving ToMMV and TMGMV (Tobacco mild green mosaic virus) and symptoms caused by ToMMV alone on eggplant have not been reported.
    • Chickpea has been reported as a natural host, but infections appear to be asymptomatic.

What is the distribution of ToMMV overseas?

  • The virus has been reported in Mexico, the USA, China, Israel and Spain. It was also detected recently by Australia on capsicum seeds for sowing exported from the Netherlands.
  • Given the global nature of the seed production cycle, it is likely that the distribution of ToMMV is greater than reported in published records.

Why has Australia implemented emergency measures for tomato and capsicum seed?

  • ToMMV is an emerging biosecurity risk to the Australian tomato and capsicum production industry.
    • ToMMV naturally infects tomato, resulting in unmarketable fruit.
    • ToMMV infection has been observed to break resistance in cultivars resistant to the related Tomato mosaic virus.
    • Potentially at-risk Australian industries include tomato and capsicum, with values of annual production of $609.9 million and $155.6 million respectively during 2017/18 (total $765.5 million).
    • Like other Tobamoviruses, there is no effective seed treatment option available for commercial quantities of ToMMV infected seed.
    • ToMMV is NOT known to be present in Australia.

What evidence exists for ToMMV spread through the movement of tomato and capsicum seed?

  • ToMMV has rapidly expanded its global distribution since first reported in 2009. The first outbreak of this virus was reported on tomatoes in Mexico in 2009, before being reported in the USA (2010), China (2013), Israel (2014) and Spain (2015).
  • One consignment of capsicum seeds for sowing exported from the Netherlands, one consignment of capsicum seeds for sowing from Spain and two consignments of tomato seeds for sowing from the USA, all intended for entry into Australia, have tested positive for ToMMV. These positive detections confirm ToMMV is seed-borne in tomato and capsicum.
  • ToMMV is a member of the Tobamovirus genus. These viruses are known to be seed-borne, can remain viable in seeds for months, and are known to be associated with the seed coat and endosperm.
  • There is currently no evidence to suggest ToMMV is seed-borne in either chickpea or eggplants, and no other natural hosts for ToMMV are known. The department will continue to monitor the literature concerning ToMMV and update emergency measures if required.
  • Several tobamoviruses are recognised as economically important seed-borne quarantine pests, including Cucumber green mottle mosaic virus (CGMMV), Kyuri green mottle mosaic virus (KGMMV) and Zucchini green mottle mosaic virus (ZGMMV) and Tomato brown rugose fruit virus (ToBRFV).

Implementation of emergency measures

[expand all]

To which host species do the emergency measures apply?

  • The department has responded to the emerging risk of ToMMV being associated with imported tomato (Solanum lycopersicum) and capsicum (Capsicum annuum species complex) seeds for sowing by introducing emergency measures.
  • The emergency measures are applied on capsicum and tomato seeds because of detections of ToMMV on imported capsicum and tomato seeds for sowing, confirming ToMMV is seed-borne.
  • The emergency measures on capsicum are applied to Capsicum annuum species complex (C. annuum, C. chinense and C. frutescens) because:
    • ToMMV is likely to be seed-borne in all three species, which are closely related
    • Hybrids of the three species are commonly bred and distributed globally
    • Seeds of the three species within the complex are similar in appearance and thus difficult to distinguish
    • Seed traders usually only identify seeds using the common name ‘capsicum’.

How will the emergency measures be implemented?

  • The emergency measure will be mandatory Polymerase Chain Reaction (PCR) testing (on-shore or off-shore) on a sample size of 20,000 seeds (or 20% for small seed lots) to verify freedom from ToMMV.
  • A transition period will be provided before the commencement of emergency measures to minimise the potential for trade disruption:
    • Transition period: Consignments that are shipped from an exporting country before midnight preceding 19 November 2019 will be permitted entry into Australia under existing arrangements (no additional measures).
    • Commencement of mandatory testing: Consignments that are shipped after midnight 19 November 2019 must undergo PCR testing for ToMMV either on-shore or off-shore.

What are the details of the department-approved PCR testing protocol(s)?

  • PCR testing protocol as specified by Levitzky et al. (2019) has been validated for the detection of ToMMV and will be implemented for the emergency measures.
    • This PCR test will only marginally increase the cost for the tomato and capsicum industries, as a separate process will not be required beyond existing requirements for other viruses/viroids.
    • Furthermore, the same primers can be used for the detection of both Tomato brown rugose fruit virus (ToBRFV) and ToMMV on capsicum and tomato seeds.
  • The department is currently considering other potential PCR primers for PCR testing. If validated, they will be added to the Approved list. The department may also consider further PCR primers and protocols on a case-by-case basis.

Approved PCR testing protocol and primers

Date approvedPrimersPCR protocol
19 November 2019F-5476 – GAAGAAGTTGTTGATGAGTTCAT
R-6287 – GATTTAAGTGGAGGGAAAAACAC
Reference
Levitzky, N, Smith, E, Lachman, O, Luria, N, Mizrahi, Y, Bakelman, H, Sela, N, Laskar, O, Milrot, E & Dombrovsky, A, 2019, ‘The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes’ PloS ONE, vol. 14, no. 1, p.e0210871.
Protocol as specified by Levitzky et al. 2019
  • Note, PCR-amplified products from positive test results can be sequenced to confirm detection of ToMMV. The outcome of the identified sequence results must be provided to the department.
  • NPPOs that propose other PCR protocols should provide a submission with evidence of test efficacy, through the SPS Contact Point.

Will the department consider increasing the sub-sample size for PCR testing?

  • At this time, the department will require the PCR test to be conducted on sub-sample sizes of no more than 400 seeds (i.e. 50 tests, each on 400 seeds).
  • A larger sub-sample size may risk false negative test results.
  • However, the department will continue to consider the possibility of increasing the sub-sample size.

Will a risk assessment be required to technically justify the emergency measures?

  • The SPS Agreement permits Australia to implement emergency actions, including emergency measures, when a new or unexpected phytosanitary risk is identified.
  • Ongoing need for the continuance of measures will be evaluated by a pest risk analysis as soon as possible, to ensure that any continuance is technically justified.

How has the department notified stakeholders of these emergency measures?

  • The department has kept ongoing communication with Australian testing laboratories.
  • The department has communicated with the seed industry bodies, such as the Australian Seed Federation. The department will also release an SPS notification to notify overseas trading partners.
  • All import permit holders will receive notifications of the changes and variations to their import permits.
  • BICON alerts will continue to be released to provide notification of the changes.
  • Importers are encouraged to actively engage with their offshore testing providers to make sure that they are familiar with Australia’s requirements.

What initial on-farm biosecurity practices should growers take?

  • It is possible that tomato and capsicum seeds infected with ToMMV may have already entered Australia. Therefore, growers are strongly encouraged to familiarise themselves with the symptoms of ToMMV infection on host crops and ensure that they have effective on-farm biosecurity practices in place, especially being vigilant for any unusual signs of virus infection on host crops.
  • Growers are also advised to contact their seed suppliers to seek their assurance about what specific testing has been applied to batches of seeds and whether they have been appropriately tested for ToMMV.
  • Reported symptoms of ToMMV infection include:
    • On tomato, symptoms include severe necrotic lesions on both leaves and fruit, chlorosis and deformation of leaves, mottle and systemic crinkling symptoms and fruit necrosis.
    • On capsicum, symptoms include foliar mottle, shrinking and necrosis.