Skip to main content Skip to main navigation Skip to search
Home

Top navigation main

  • News & media
  • Jobs
  • Ministers
  • Contact us
Main menu

AWE Main

  • Agriculture and land
    Agriculture and land Building stronger and more sustainable agriculture, fisheries, forestry and land care.
    • Animal health
    • Climate change and agriculture
    • Farming, food and rural support
    • Fisheries
    • Forestry
    • Levies and charges on agricultural products
    • Mouse infestation advice
    • Plant health
    Farmer in a wheat field at sunset

    Drought, disaster and rural support

    Farmers and rural communities face many risks to their business.

    Find out more

  • Biosecurity and trade
    Biosecurity and trade
    • Aircraft, vessels and military
    • Biosecurity policy
    • Cats and dogs
    • Exporting
    • Importing
    • Pests, diseases and weeds
    • Public awareness and education
    • Trade and market access
    • Travelling or sending goods to Australia
    • Report a concern
    Brown marmorated stink bug

    BMSB Seasonal Measures

    Australia has strengthened seasonal measures to manage the risk of BMSB.

    View our seasonal measures

  • Science and research
    Science and research Undertaking research and collecting data to support informed decisions and policies.
    • Australian Bureau of Agricultural and Resource Economics and Sciences (ABARES)
    • Plant Innovation Centre
    Abares

    ABARES Insights

    Get 'snapshots’ of agricultural, forestry and fisheries industries, or analysis of key issues.

    Find out more

  • About us
    About us We enhance our agricultural industries and trade, and manage the threat of biosecurity risks to Australia.
    • Accountability and reporting
    • Assistance, grants and tenders
    • Contact us
    • Fees and charges
    • News and media
    • Our commitment to you
    • Payments
    • People and jobs
    • Publications
    • What we do
    • Who we are
    Budget 2026-27

    Budget 2026-27

    The 2026–27 Portfolio Budget Statements were released on 12 May 2026.

    Find out more

  • Online services
    Online services We do business with you using online platforms. This makes it easier for you to meet your legal requirements.
Department of Agriculture

Breadcrumb

  1. Home
  2. Biosecurity and trade
  3. Import
  4. Importing goods
  5. Plants and plant products
  6. Importing seeds for planting
  7. Pathogen testing requirements for tomato and capsicum seeds

Sidebar first - Import

  • Seeds for planting
    • Department authorised seed pathogen testing laboratories
    • Applications for approval of new phytosanitary treatments for seeds
    • Coversheet for seed for planting consignments
    • Department approved seed purity testing laboratories
    • Emergency measures for tomato and capsicum seed
    • Pathogen testing requirements for tomato and capsicum seeds
    • International Clean Seed Pathway Workshop
    • Pathogen test request form
    • Reviewing laboratory test reports checklists
    • Seed contaminants and tolerance tables
    • Vegetable seeds policy review

Pathogen testing requirements for tomato and capsicum seeds

Phase 1 - Updated seed testing protocols for Tomato brown rugose fruit virus and Tomato mottle mosaic virus

We have completed the first phase of our review of Australia’s import conditions for tomato and capsicum seed disease testing.

This initial phase focused on evaluating seed testing protocols for Tomato brown rugose fruit virus (ToBRFV) and Tomato mottle mosaic virus (ToMMV), as well as the authorisation process for laboratories conducting these tests.

As a result of this review, we have made 2 key changes to strengthen the seed testing requirements:

  1. We have established a list of authorised laboratories registered to test tomato and capsicum seed for ToBRFV and ToMMV for export to Australia

  2. We have updated the list of approved testing protocols for detecting ToBRFV and ToMMV.

These changes aim to improve assurance in laboratory testing and ensure consistent interpretation of results. They will ensure seed is tested using the most suitable protocols and requirements for detecting ToBRFV and ToMMV.

The new requirements became mandatory import conditions on 12 November 2025.

Phase 2 - wider review of seed pathogen testing

We announced the commencement of Phase 2, a wider review of diagnostic testing requirements for tomato and capsicum seed, on 12 May 2026.

This phase builds on Phase 1 and focuses on the remaining regulated seed pathogen tests. The aim is to ensure these tests are technically robust, appropriately validated and fit for purpose to manage biosecurity risk consistent with Australia’s Appropriate Level of Protection (ALOP).

Phase 2 of the review is focused on the remaining tomato and capsicum seed pathogens:

  • Pepino mosaic virus
  • Columnea latent viroid
  • Pepper chat fruit viroid
  • Potato spindle tuber viroid
  • Tomato apical stunt viroid.

The review includes consideration of:

  • testing protocols
  • interpretation of results 
  • laboratory authorisation requirements.

Phase 2 does not introduce new seed pathogens and does not include Tomato brown rugose fruit virus (ToBRFV) or Tomato mottle mosaic virus (ToMMV), which were addressed in Phase 1.

Note: There are no immediate changes to the import conditions or testing requirements as a result of Phase 2. Current testing and laboratory authorisation requirements continue to apply until further notice.

Consultation and next steps

We plan to release the draft report for consultation in mid-2027. Please note that this is an indicative timeline and may be subject to change. We will notify permit holders in advance of any proposed changes to import conditions.

Authorised laboratories

Under the updated import conditions from Phase 1, tomato and capsicum seed lots must be tested for ToBRFV and ToMMV by an authorised laboratory.

Laboratories intending to conduct this testing for seed exports to Australia must register to become authorised. To do so, laboratories must complete the registration form below, confirming their agreement to implement the new testing requirements and protocols.

Laboratories must submit their completed form via email to imports@aff.gov.au. Note: please include ‘Plant T2 - Seed for sowing – Laboratory authorisation’ in the subject line of the email.

Registration form for authorisation of seed pathogen testing

  • Download PDF 300 KB
  • Download Word 259 KB

If you have difficulty accessing these files, contact us for help.

The list of authorised laboratories is published on the Department authorised seed testing laboratories webpage. 

Approved testing protocols

We have updated the list of approved testing protocols for detecting ToBRFV and ToMMV in tomato and capsicum seed. The new requirements became mandatory import conditions on 12 November 2025.

Some existing seed testing requirements will remain unchanged and continue to apply under the updated protocols. Laboratory test reports for tomato and capsicum seed for export must continue to include the following details:

  1. The name and address of the testing laboratory
  2. The full botanical name of the species tested
  3. The date of testing
  4. The type of test done
  5. The seed lot number(s)
  6. The sample size, which must be 20,000 seeds or 20% of the seed lot for small seed lots
  7. The subsample size, which must be no greater than 400 seeds per subsample for all testing conducted by PCR
  8. The pathogens targeted
  9. The test result confirming freedom from each of the targeted pathogens.

Full testing requirements are available on BICON.

The updated list of approved testing protocols for detecting ToBRFV and ToMMV in tomato and capsicum seed for export to Australia, along with associated requirements, is detailed below:

  • Laboratories must use 2 reverse-transcription qPCR protocols to verify the status of ToBRFV and ToMMV in each seed lot.
  • For ToBRFV, the CaTa28 protocol must be used as one of the 2 qPCR protocols, and either the CSP1325 protocol or the qs1/p1/qas2 protocol must be used as the second protocol (see Table 1 and Table 2).
  • For ToMMV, the CaTa9 protocol must be used as one of the 2 qPCR protocols, and either the CSP1572 protocol or the ToMMV2 protocol must be used as the second protocol (see Table 1 and Table 2).
  • References to the approved protocols are listed in Table 3. Please note that the department’s requirements for these protocols and for reporting results may differ from some of the parameters stated in the references.
  • No other tests are approved for verifying the status of a seed lot regarding these 2 viruses. Laboratories shall not discount a positive result obtained from an approved qPCR test on the basis of any other test result or consideration, except retesting following the ‘Retesting’ section.
Table 1. Summary of required testing protocols
VirusFirst required protocolSecond required protocol
ToBRFVCaTa28 reverse-transcription qPCRCSP1325 reverse-transcription qPCR

OR

Menzel and Winter reverse-transcription qPCR (qs1/p1/qas2)
ToMMVCaTa9 reverse-transcription qPCRCSP1572 reverse-transcription qPCR

OR

ToMMV2 reverse-transcription qPCR

  • The testing protocols that will no longer be approved for use from 12 November 2025 for detecting ToBRFV and ToMMV are listed in Table 4.

  • Extraction and amplification positive controls must be run and should include an RNA target. At least one weak positive control should be used that produces a Ct value of 30 or higher.
  • At least one negative control should be run. If any negative controls yield Ct values below 35, the testing should be considered invalid, and the department should be contacted.

  • A Ct cut-off value of 35 applies to all qPCR tests for ToBRFV and ToMMV. A statement must be included on laboratory reports that states the Ct cut-off point used to determine the result.
  • The lowest Ct value obtained for a subsample must be used to interpret the result for that subsample.
  • If the Ct value of the subsample is equal to or below 35, this will be considered a positive result, i.e. the target virus has been detected.
  • If the Ct value of the subsample is above 35, this will be considered a negative result, i.e. the target virus has not been detected.
  • If a laboratory considers that further information is relevant to the interpretation of a set of test results for a seed lot, the laboratory can contact the department for advice. We will consider the information before making a final decision on the status of the seed lot.

A laboratory may re-run a qPCR where the result is considered to be potentially anomalous. For example, if the amplification curve deviates substantially from a typical sigmoidal shape this may be considered anomalous, and the qPCR may be re-run.

  • Retesting must be conducted using the seed homogenate (seed slurry) or RNA extract from the same seed subsample.
  • An anomalous or ambiguous qPCR result cannot be superseded by testing a different seed sample or subsample.
  • At least two additional replicate qPCR reactions must be done for the re-test and the same qPCR protocol that produced the anomalous result must be used for those reactions.
  • The results from the retest must be interpreted according to the ‘Ct cut-offs and interpretation requirements’ specified above.
  • Any anomalous finding that has not been shown to be negative by retesting based on the interpretation requirements, must be reported as a positive.

  • We may conduct retesting or trace back investigations of seed lots. Laboratories must provide records of previous testing to assist with these investigations.
  • Laboratories must keep copies of the quality control records, protocols used and any validation and verification reports relevant to the tests, and must provide these documents upon request by the department .
  • Laboratories must keep records of all testing done to meet the Australian requirements for at least 3 years, including Ct values, records of decisions about test results, negative test results, retest results, anomalous results, and results from controls. Images of amplification curves of anomalous results should also be kept.
  • If a laboratory resolves an anomalous result and concludes that a seed lot is negative for the virus, the laboratory must record the reason why the anomalous result was considered not to be a detection of the virus.

Table 2. Approved protocols and result interpretation for ToBRFV and ToMMV, effective 12 November 2025
VirusProtocolPrimers and probeDate approved
ToBRFVCaTa28
reverse-transcription qPCR
CaTa28  forward  GGTGGTGTCAGTGTCTGTTT    
CaTa28  reverse   GCGTCCTTGGTAGTGATGTT    
CaTa28    6FAM-GAGAATGGAGAGAGCGGACGAGG-BHQ1
24 June 2019    
CSP1325
reverse-transcription qPCR
CSP1325  forward CATTTGAAAGTGCATCCGGTTT   
CSP1325  reverse  GTACCACGTGTGTTTGCAGACA  
CSP1325     VIC*-ATGGTCCTCTGCACCTGCATCTTGAGA- BHQ1
*can be FAM
7 June 2019    
qs1/p1/qas2 
Menzel and Winter
reverse-transcription qPCR
ToBRFV qs1  forward  CAATCAGAGCACATTTGAAAGTGCA 
ToBRFV qas2 reverse   CAGACACAATCTGTTATTTAAGCATC ToBRFV p16
6-FAM-ACAATGGTCCTCTGCACCTG- BHQ1
12 November 2025
ToMMVCaTa9
reverse-transcription qPCR
CaTa9 forward  ATGTGGAGGAACCCTCTATGA    
CaTa9  reverse   AATCTCCTCGCTCCTTGTAAAC    
CaTa9P   ROX-TCAATGGCCCGTGGTGAGTTACAA-BHQ1
12 November 2025
CSP1572
reverse-transcription qPCR
CSP 1572 forward CCCGACTACAGCCGAAACAT
CSP 1572 reverse TTAACAGCGGACCTGATCGC
 
12 November 2025
ToMMV2
reverse-transcription qPCR
ToMMV2   forward     GAAACATTGGATGCCACTCG 
ToMMV 2   reverse      CTCTGGTTGTAGAAACCTGTTCC
ToMMV2p  FAM-CGATGCTACGGTTGCGATCAGGTC-BHQ1
12 November 2025
Table 3. References to protocols
ProtocolReference
CaTa28
  • Berendsen SMH, Tavares C, Hiddink G, and Woudenberg JHC (2020). Detection of Tomato brown rugose fruit virus (ToBRFV) in tomato and pepper seed by SE-PCR. ISHI-Veg, Validation Report. https://worldseed.org/wp-content/uploads/2020/09/2020_Validation-Report-_ToBRFV_Tomato-Pepper_W.pdf
  • ISHI-Veg 2019. Detection of Infectious Tomato brown
    rugose fruit virus (ToBRFV) in Tomato and Pepper Seed.
    https://www.worldseed.org/wp-content/uploads/2019/09/Tomato-ToBRFV_2019.09.pdf
CSP1325
  • Berendsen SMH, Tavares C, Hiddink G, and Woudenberg JHC (2020). Detection of Tomato brown rugose fruit virus (ToBRFV) in tomato and pepper seed by SE-PCR. ISHI-Veg, Validation Report. https://worldseed.org/wp-content/uploads/2020/09/2020_Validation-Report-_ToBRFV_Tomato-Pepper_W.pdf
Menzel and Winter 
  • Menzel W, and Winter S. (2021). Identification of novel and known tobamoviruses in tomato and other solanaceous crops using a new pair of generic primers and development of a specific RT-qPCR for ToBRFV. Acta Horticulturae. 1316, 143-148 DOI: 10.17660/ActaHortic.2021.1316.20
  • EPPO (2021), PM 7/146 (1) Tomato brown rugose fruit virus. EPPO Bulletin 51: 178-197. https://doi.org/10.1111/epp.12723
CaTa9
  • Mehle, N et al. (2024). ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study. Euphresco DROP - ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study
CSP1572
  • Mehle, N et al. (2024). ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study. Euphresco DROP - ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study
ToMMV2
  • Mehle, N et al. (2024). ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study. Euphresco DROP - ToMMV-detect 2022-A-394 Interlaboratory Test Performance Study
Table 4. PCR protocols removed from the approved list
Protocol and PrimersReasonApproval period

Levitzky et al. 2019

F    GAAGAAGTTGTTGATGAGTTCAT
R   GATTTAAGTGGAGGGAAAAACAC

Reference
Levitzky, N, Smith, E, Lachman, O, Luria, N, Mizrahi, Y, Bakelman, H, Sela, N, Laskar, O, Milrot, E & Dombrovsky, A, 2019, ‘The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes’ PloS one, volume14, issue 1, p.e0210871.

The protocol of Levitzky et al. 2019 is not suitable for the detection of ToBRFV and ToMMV as it is not sufficiently sensitive and uses a group specific primer set. 1 April 2019  - 12 November 2025

Alkowni et al. 2019  

F      AATGTCCATGTTTGTTACGCC
R     CGAATGTGATTTAAAACTGTGAAT

Reference
Alkowni, A, Alabdallah, O & Fadda, Z 2019, ‘Molecular identification of tomato brown rugose fruit virus in tomato in Palestine’ Journal of Plant Pathology, available at DOI 10.1007/s42161-019-00240-7.

The protocol of Alkowni et al. 2019 is not suitable for the detection of ToBRFV as it is not sufficiently sensitive.1 April 2019  - 12 November 2025

Li et al 2018

TobamodF   TKGAYGGNGTBCCNGGNTGYGG
TobamodR   ACNGAVTBNABCTGTAATTGCTAT

Reference:
Li, Y, Tan, G, Lan, P, Zhang, A, Liu, Y, Li, R, & Li, F, 2018, ‘Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers’ Journal of virological methods, volume 259, pp.122-128.

Test results indicate that the protocol of Li et al. (2018) is not sufficiently sensitive. The protocol was removed from the approved list on 7 June 2019.1 April 2019 - 7 June 2019  

General enquiries

Call 1800 900 090

Contact us online

Report a biosecurity concern

Thanks for your feedback.
Thanks! Your feedback has been submitted.

We aren't able to respond to your individual comments or questions.
To contact us directly phone us or submit an online inquiry

CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.

Please verify that you are not a robot.

Skip
Page last updated: 12 May 2026

We acknowledge the continuous connection of First Nations Traditional Owners and Custodians to the lands, seas and waters of Australia. We recognise their care for and cultivation of Country. We pay respect to Elders past and present, and recognise their knowledge and contribution to the productivity, innovation and sustainability of Australia’s agriculture, fisheries and forestry industries.

Artwork: Protecting our Country, Growing our Future
© Amy Allerton, contemporary Aboriginal Artist of the Gumbaynggirr, Bundjalung and Gamilaroi nations.

Footer

  • Contact us
  • Accessibility
  • Disclaimer
  • Privacy
  • FOI

© Department of Agriculture, Fisheries and Forestry

Facebook X LinkedIn Instagram